pCRII-Topo Cav1 in situ probe
(Plasmid
#45624)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45624 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCRII-Topo
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4600
-
Vector typein situ
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCav1 in situ probe
-
Alt nameCav1
-
Alt namecaveolin 1
-
Alt namecaveolae protein
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)653
-
Mutationfragment contains bp# 1472-2124 of AB029929.1
-
GenBank IDNM_007616
-
Entrez GeneCav1 (a.k.a. Cav, Cav-1)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer M13 Rev, Sp6
- 3′ sequencing primer T7, M13 Forward (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The Cav1 fragment was amplified by RT-PCR using the following primer pair:
ACCTCTCTGGACTGGCAGAA
AGTGTCGGCAAGACTGAAGG
For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the Spe1 restriction digest and T7 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp# 1472-2124 of AB029929.1, but found single nucleotide mismatches at bp# 1501 & 1574. The plasmid functions as described in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRII-Topo Cav1 in situ probe was a gift from Jeffrey Macklis (Addgene plasmid # 45624 ; http://n2t.net/addgene:45624 ; RRID:Addgene_45624) -
For your References section:
Novel subtype-specific genes identify distinct subpopulations of callosal projection neurons. Molyneaux BJ, Arlotta P, Fame RM, MacDonald JL, MacQuarrie KL, Macklis JD. J Neurosci. 2009 Sep 30;29(39):12343-54. doi: 10.1523/JNEUROSCI.6108-08.2009. 10.1523/JNEUROSCI.6108-08.2009 PubMed 19793993
Map uploaded by the depositor.
