Skip to main content

pCRII-Topo Cav1 in situ probe
(Plasmid #45624)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45624 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCRII-Topo
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 4600
  • Vector type
    in situ

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cav1 in situ probe
  • Alt name
    Cav1
  • Alt name
    caveolin 1
  • Alt name
    caveolae protein
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    653
  • Mutation
    fragment contains bp# 1472-2124 of AB029929.1
  • GenBank ID
    NM_007616
  • Entrez Gene
    Cav1 (a.k.a. Cav, Cav-1)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Cav1 fragment was amplified by RT-PCR using the following primer pair:
ACCTCTCTGGACTGGCAGAA
AGTGTCGGCAAGACTGAAGG

For in vitro transcription, use the NotI restriction digest and Sp6 promoter for sense probe generation and the Spe1 restriction digest and T7 promoter for antisense probe generation.

Please note that Addgene's sequencing results match bp# 1472-2124 of AB029929.1, but found single nucleotide mismatches at bp# 1501 & 1574. The plasmid functions as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRII-Topo Cav1 in situ probe was a gift from Jeffrey Macklis (Addgene plasmid # 45624 ; http://n2t.net/addgene:45624 ; RRID:Addgene_45624)
  • For your References section:

    Novel subtype-specific genes identify distinct subpopulations of callosal projection neurons. Molyneaux BJ, Arlotta P, Fame RM, MacDonald JL, MacQuarrie KL, Macklis JD. J Neurosci. 2009 Sep 30;29(39):12343-54. doi: 10.1523/JNEUROSCI.6108-08.2009. 10.1523/JNEUROSCI.6108-08.2009 PubMed 19793993