pLKO.1-lincRNA-RoR-sh1 (Linc-sh1)
(Plasmid
#45764)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45764 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1-puro
-
Backbone manufacturerBob Weinberg
- Backbone size w/o insert (bp) 7032
- Total vector size (bp) 7094
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namelincRNA-RoR-shRNA1
-
Alt nameLinc-sh1
-
gRNA/shRNA sequenceLincRNA-RoR
-
SpeciesH. sapiens (human)
-
Entrez GeneLINC-ROR (a.k.a. ROR, lincRNA-RoR, lincRNA-ST8SIA3)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer CAAGGCTGTTAGAGAGATAATTGGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-lincRNA-RoR-sh1 (Linc-sh1) was a gift from George Daley (Addgene plasmid # 45764 ; http://n2t.net/addgene:45764 ; RRID:Addgene_45764) -
For your References section:
Large intergenic non-coding RNA-RoR modulates reprogramming of human induced pluripotent stem cells. Loewer S, Cabili MN, Guttman M, Loh YH, Thomas K, Park IH, Garber M, Curran M, Onder T, Agarwal S, Manos PD, Datta S, Lander ES, Schlaeger TM, Daley GQ, Rinn JL. Nat Genet. 2010 Dec;42(12):1113-7. Epub 2010 Nov 7. 10.1038/ng.710 PubMed 21057500