Skip to main content

pBEST-OR2-OR1-Pr-UTR1-araC-T500
(Plasmid #45786)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45786 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBEST-Luc
  • Backbone manufacturer
    Promega
  • Modifications to backbone
    pTacI promoter was removed and replaced by the bacteriophage Lambda promoter OR2-OR1-Pr, with one mutation made in this promoter. Untranslated region was removed and replaced by UTR1, a powerful UTR. Luc gene (firefly Luciferase) was removed and replaced by araC. A transcriptional terminator was added, called T500.
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    KL740
  • Growth instructions
    Grow at 29C in strain KL740, LB medium.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    araC
  • Insert Size (bp)
    930
  • Promoter OR2-OR1-Pr (bacteriophage Lambda with one mutation)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CATGGTGAAGACTATCGCAC
  • 3′ sequencing primer GAAGGAGCTGACTGGGTTGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Vincent Noireaux, University of Minnesota

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBEST-OR2-OR1-Pr-UTR1-araC-T500 was a gift from Richard Murray (Addgene plasmid # 45786 ; http://n2t.net/addgene:45786 ; RRID:Addgene_45786)