Skip to main content

pBEST-OR2-OR1-Pr-araC, pBAD-TetR, pBAD-TetO1-deGFP-ssrA
(Plasmid #45789)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45789 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBEST-Luc
  • Backbone manufacturer
    Promega
  • Modifications to backbone
    There are 3 inserts on this plasmid. The untranslated region for all 3 is UTR1, a powerful UTR. The transcriptional terminator for all 3 is called T500. In 5' to 3' order, the inserts are: pBAD-tetO1 (repressed by TetR)-UTR1-deGFP-ssrA-T500, pBAD-UTR1-TetR-T500, and OR2-OR1-Pr (bacteriophage lambda with one mutation)-UTR1-araC-T500. The pBAD-TetR insert is inverted. DeGFP is tagged with a ssrA degradation tag.
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    KL740
  • Growth instructions
    Grow at 29C in strain KL740, LB medium.
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    deGFP
  • Alt name
    eGFP-Del6-229
  • Insert Size (bp)
    675
  • Promoter pBAD-tetO1
  • Tag / Fusion Protein
    • ssrA degradation tag

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer ATTGTCTCATGAGCGGATAC
  • 3′ sequencing primer CCGGTTTCACCACAGAAAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Tetracycline repressor
  • Alt name
    TetR
  • Insert Size (bp)
    624
  • Promoter pBAD

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer CTTTCTGTGGTGAAACCGG
  • 3′ sequencing primer GTGCGATAGTCTTCACCATG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    araC
  • Insert Size (bp)
    930
  • Promoter OR2-OR1-Pr (bacteriophage Lambda with one mutation)

Cloning Information for Gene/Insert 3

  • Cloning method Unknown
  • 5′ sequencing primer CATGGTGAAGACTATCGCAC
  • 3′ sequencing primer CACCTGTCCTACGAGTTGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Vincent Noireaux, University of Minnesota
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBEST-OR2-OR1-Pr-araC, pBAD-TetR, pBAD-TetO1-deGFP-ssrA was a gift from Richard Murray (Addgene plasmid # 45789 ; http://n2t.net/addgene:45789 ; RRID:Addgene_45789)