pBEST-OR2-OR1-Pr-araC, pBAD-TetR, pBAD-TetO1-deGFP-ssrA
(Plasmid
#45789)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45789 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBEST-Luc
-
Backbone manufacturerPromega
-
Modifications to backboneThere are 3 inserts on this plasmid. The untranslated region for all 3 is UTR1, a powerful UTR. The transcriptional terminator for all 3 is called T500. In 5' to 3' order, the inserts are: pBAD-tetO1 (repressed by TetR)-UTR1-deGFP-ssrA-T500, pBAD-UTR1-TetR-T500, and OR2-OR1-Pr (bacteriophage lambda with one mutation)-UTR1-araC-T500. The pBAD-TetR insert is inverted. DeGFP is tagged with a ssrA degradation tag.
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)KL740
-
Growth instructionsGrow at 29C in strain KL740, LB medium.
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namedeGFP
-
Alt nameeGFP-Del6-229
-
Insert Size (bp)675
- Promoter pBAD-tetO1
-
Tag
/ Fusion Protein
- ssrA degradation tag
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer ATTGTCTCATGAGCGGATAC
- 3′ sequencing primer CCGGTTTCACCACAGAAAG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTetracycline repressor
-
Alt nameTetR
-
Insert Size (bp)624
- Promoter pBAD
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer CTTTCTGTGGTGAAACCGG
- 3′ sequencing primer GTGCGATAGTCTTCACCATG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namearaC
-
Insert Size (bp)930
- Promoter OR2-OR1-Pr (bacteriophage Lambda with one mutation)
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer CATGGTGAAGACTATCGCAC
- 3′ sequencing primer CACCTGTCCTACGAGTTGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byVincent Noireaux, University of Minnesota
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBEST-OR2-OR1-Pr-araC, pBAD-TetR, pBAD-TetO1-deGFP-ssrA was a gift from Richard Murray (Addgene plasmid # 45789 ; http://n2t.net/addgene:45789 ; RRID:Addgene_45789)