MG-miR125b-sponge-bulge
(Plasmid
#45790)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45790 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneMSCV EGFP (MG vector)
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiR125b sponge
- Promoter MSCV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NOT1 (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer caccctaagcctccgcctcctct (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MG-miR125b-sponge-bulge was a gift from David Baltimore (Addgene plasmid # 45790 ; http://n2t.net/addgene:45790 ; RRID:Addgene_45790) -
For your References section:
Oncomir miR-125b regulates hematopoiesis by targeting the gene Lin28A. Chaudhuri AA, So AY, Mehta A, Minisandram A, Sinha N, Jonsson VD, Rao DS, O'Connell RM, Baltimore D. Proc Natl Acad Sci U S A. 2012 Mar 13;109(11):4233-8. doi: 10.1073/pnas.1200677109. Epub 2012 Feb 24. 10.1073/pnas.1200677109 PubMed 22366319
Map uploaded by the depositor.
