Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #45851)


Item Catalog # Description Quantity Price (USD)
Plasmid 45851 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6265
  • Total vector size (bp) 10047
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    PECAM1 (a.k.a. CD31, CD31/EndoCAM, GPIIA', PECA1, PECAM-1, endoCAM)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: Compared to the current NCBI reference sequence for PECAM1, this plasmid has a V125L substitution. This is a known SNP. Also, two silent mutations were introduced to destroy two internal EcoRI sites.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLPCX-PECAMTL was a gift from Martin Schwartz (Addgene plasmid # 45851 ; ; RRID:Addgene_45851)
  • For your References section:

    Fluid Shear Stress on Endothelial Cells Modulates Mechanical Tension across VE-Cadherin and PECAM-1. Conway DE, Breckenridge MT, Hinde E, Gratton E, Chen CS, Schwartz MA. Curr Biol. 2013 May 14. pii: S0960-9822(13)00490-9. doi: 10.1016/j.cub.2013.04.049. 10.1016/j.cub.2013.04.049 PubMed 23684974