pLPCX-PECAMTL
(Plasmid
#45851)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45851 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLPCX
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 6265
- Total vector size (bp) 10047
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePECAM1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3800
-
Entrez GenePECAM1 (a.k.a. CD31, CD31/EndoCAM, GPIIA', PECA1, PECAM-1, endoCAM)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: Compared to the current NCBI reference sequence for PECAM1, this plasmid has a V125L substitution. This is a known SNP. Also, two silent mutations were introduced to destroy two internal EcoRI sites.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLPCX-PECAMTL was a gift from Martin Schwartz (Addgene plasmid # 45851 ; http://n2t.net/addgene:45851 ; RRID:Addgene_45851) -
For your References section:
Fluid Shear Stress on Endothelial Cells Modulates Mechanical Tension across VE-Cadherin and PECAM-1. Conway DE, Breckenridge MT, Hinde E, Gratton E, Chen CS, Schwartz MA. Curr Biol. 2013 May 14. pii: S0960-9822(13)00490-9. doi: 10.1016/j.cub.2013.04.049. 10.1016/j.cub.2013.04.049 PubMed 23684974