-
PurposeCarmine intensiometric genetically encoded Ca2+-indicators for optical imaging
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46022 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1 (-)
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 6854
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCAR-GECO1
-
SpeciesSynthetic
-
Insert Size (bp)1254
-
MutationR-GECO1 E163V/I166V/V174T/M176I/F222I/A302P
-
GenBank IDKF186684
- Promoter CMV
-
Tag
/ Fusion Protein
- a duplex of the mitochondrial targeting signal of cytochrome c oxidase subunit VIII (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The vector of the CMV-mito-CAR-GECO1 is based on the mitATeam1.03 pcDNA plasmid reported here:
(http://www.pnas.org/content/106/37/15651.abstract)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-mito-CAR-GECO1 was a gift from Robert Campbell (Addgene plasmid # 46022 ; http://n2t.net/addgene:46022 ; RRID:Addgene_46022) -
For your References section:
Improved Orange and Red Ca Indicators and Photophysical Considerations for Optogenetic Applications. Wu J, Liu L, Matsuda T, Zhao Y, Rebane A, Drobizhev M, Chang YF, Araki S, Arai Y, March K, Hughes TE, Sagou K, Miyata T, Nagai T, Li WH, Campbell RE. ACS Chem Neurosci. 2013 Mar 19. 10.1021/cn400012b PubMed 23452507