Skip to main content

pQUASp
(Plasmid #46162)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46162 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUASp
  • Backbone size (bp) 9909
  • Modifications to backbone
    Removed UAS enhancers and replaced with 15 copies of QUAS enhancer elements
  • Vector type
    Insect Expression
  • Selectable markers
    white

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer pCasper-F
  • 3′ sequencing primer ACCAGGGGATGCTTAATTGTGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQUASp was a gift from Christopher Potter (Addgene plasmid # 46162 ; http://n2t.net/addgene:46162 ; RRID:Addgene_46162)
  • For your References section:

    Organization of olfactory centres in the malaria mosquito Anopheles gambiae. Riabinina O, Task D, Marr E, Lin CC, Alford R, O'Brochta DA, Potter CJ. Nat Commun. 2016 Oct 3;7:13010. doi: 10.1038/ncomms13010. 10.1038/ncomms13010 PubMed 27694947