-
PurposeClaudin-1 promoter reporter assay
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46387 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL4.10
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4242
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCLDN1 Promoter
-
SpeciesH. sapiens (human)
-
GenBank ID
-
Entrez GeneCLDN1 (a.k.a. CLD1, ILVASC, SEMP1)
- Promoter CLDN1 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAGCAAAATAGGCTGTCCCC
- 3′ sequencing primer GCTGGGCCCTTCTTAATGTT
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4.10-Claudin-1 was a gift from David Mu (Addgene plasmid # 46387 ; http://n2t.net/addgene:46387 ; RRID:Addgene_46387) -
For your References section:
Occludin is a direct target of thyroid transcription factor-1 (TTF-1/NKX2-1). Runkle EA, Rice SJ, Qi J, Masser D, Antonetti DA, Winslow MM, Mu D. J Biol Chem. 2012 Aug 17;287(34):28790-801. doi: 10.1074/jbc.M112.367987. Epub 2012 Jul 2. 10.1074/jbc.M112.367987 PubMed 22761434
Map uploaded by the depositor.