Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pMA3288
(Plasmid #46885)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 46885 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMA2780
  • Backbone manufacturer
    Homemade
  • Backbone size w/o insert (bp) 6686
  • Total vector size (bp) 7418
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Uracil-N-glycosylase WT
  • Alt name
    UNG, UDG
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    830
  • Entrez Gene
    UNG (a.k.a. DGU, HIGM4, HIGM5, UDG, UNG1, UNG15, UNG2)
  • Promoter TRE-Tight
  • Tag / Fusion Protein
    • Myc

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer ctatagtgaatagagttagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMA3288 was a gift from Mikhail Alexeyev (Addgene plasmid # 46885 ; http://n2t.net/addgene:46885 ; RRID:Addgene_46885)
  • For your References section:

    Persistent damage induces mitochondrial DNA degradation. Shokolenko IN, Wilson GL, Alexeyev MF. DNA Repair (Amst). 2013 Jul;12(7):488-99. doi: 10.1016/j.dnarep.2013.04.023. Epub 2013 May 27. 10.1016/j.dnarep.2013.04.023 PubMed 23721969