-
PurposeFor constitutive or doxycycline-inducible expression of the site specific homing nuclease I-PpoI (human codon optimized). Confers resistance to puro. Use T-REx cells for doxy-inducible expression.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46963 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepICE
- Backbone size w/o insert (bp) 5044
- Total vector size (bp) 5530
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-I-PpoI
-
SpeciesPhysarum polycephalum
-
Insert Size (bp)570
- Promoter CMV-TET
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HinIII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GTAGGCGTGTACGGTGGGAGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICE-HA-NLS-I-PpoI was a gift from Steve Jackson (Addgene plasmid # 46963 ; http://n2t.net/addgene:46963 ; RRID:Addgene_46963) -
For your References section:
A new method for high-resolution imaging of Ku foci to decipher mechanisms of DNA double-strand break repair. Britton S, Coates J, Jackson SP. J Cell Biol. 2013 Jul 29. 10.1083/jcb.201303073 PubMed 23897892