pICH86966
(Plasmid
#46967)
-
Purpose(Empty Backbone) A binary vector for in planta gene expression (kindly provided by S. Marillonnet, based on the modular cloning system described in Weber et al. (PLoS One 6:e16765, 2011)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46967 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepICH86966
- Backbone size (bp) 6932
-
Vector typePlant expression
- Promoter 35S
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrows slowly, better incubate for 2 days
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer gtggtgtaaacaaattgacgc
- 3′ sequencing primer ggataaaccttttcacgccc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySylvestre Marillonnet (Leibniz Institute of Plant Biochemistry, Germany)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information on Kamoun Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Kamoun/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICH86966 was a gift from Sophien Kamoun (Addgene plasmid # 46967) -
For your References section:
Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nekrasov V, Staskawicz B, Weigel D, Jones JD, Kamoun S. Nat Biotechnol. 2013 Aug 8;31(8):691-3. doi: 10.1038/nbt.2655. 10.1038/nbt.2655 PubMed 23929340