-
PurposeEncodes the Arabidopsis U6 promoter in a level 0 vector (Weber et al. PLoS One 6:e16765, 2011). It is used to place an sgRNA uder the Arabidopsis U6 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46968 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepICSL01009
- Backbone size w/o insert (bp) 2243
- Total vector size (bp) 2323
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAtU6p
-
SpeciesSynthetic
-
Insert Size (bp)80
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bsa I (not destroyed)
- 3′ cloning site Bsa I (not destroyed)
- 5′ sequencing primer CGTTATCCCCTGATTCTGTGGATAAC
- 3′ sequencing primer GTCTCATGAGCGGATACATATTTGAATG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The backbone of the plasmid is a modified backbone of a level 0 vector from Weber et al. (PLoS One 6:e16765, 2011)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICSL01009::AtU6p was a gift from Sophien Kamoun (Addgene plasmid # 46968 ; http://n2t.net/addgene:46968 ; RRID:Addgene_46968) -
For your References section:
Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nekrasov V, Staskawicz B, Weigel D, Jones JD, Kamoun S. Nat Biotechnol. 2013 Aug 8;31(8):691-3. doi: 10.1038/nbt.2655. 10.1038/nbt.2655 PubMed 23929340