-
PurposeInducible expression of 3xMBT (D355N) from L3MBTL1 as a GST fusion protein in E.coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46988 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEX-6P-1
-
Backbone manufacturerGE Healthcare
- Backbone size w/o insert (bp) 4984
- Total vector size (bp) 5987
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsProtein expression with 0.1 mM IPTG added during log-phase growth and incubated overnight at 20C.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTriple MBT domain from human L3MBTL1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1023
-
MutationMutation aspartic acid 355 to asparagine (D355N); contains amino acids 190–530 of NP_056293.4
-
GenBank IDNM_015478.6
-
Entrez GeneL3MBTL1 (a.k.a. H-L(3)MBT, L3MBTL, ZC2HC3, dJ138B7.3)
- Promoter tac
-
Tags
/ Fusion Proteins
- GST (N terminal on backbone)
- PreScission cleavage site (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer 5'-d[GGGCTGGCAAGCCACGTTTGGTG]-3'
- 3′ sequencing primer 5'-d[CCGGGAGCTGCATGTGTCAGAGG]-3'
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Original description of the plasmid in West et al. J Biol Chem. 2010 Nov 26;285(48):37725-32.
Please note that Addgene's sequencing results found a 23bp insert between bp# 1975/1976 when compared to the full plasmid sequence. The extra sequence is a second stop codon and an EcoRI site, followed by part of the MCS.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX6P1-3xMBT_D355N was a gift from Or Gozani (Addgene plasmid # 46988 ; http://n2t.net/addgene:46988 ; RRID:Addgene_46988) -
For your References section:
A general molecular affinity strategy for global detection and proteomic analysis of lysine methylation. Moore KE, Carlson SM, Camp ND, Cheung P, James RG, Chua KF, Wolf-Yadlin A, Gozani O. Mol Cell. 2013 May 9;50(3):444-56. doi: 10.1016/j.molcel.2013.03.005. Epub 2013 Apr 11. 10.1016/j.molcel.2013.03.005 PubMed 23583077