FLAG-KIF17-short-pcDNA3
(Plasmid
#47545)
-
PurposeExpresses FLAG epitope-tagged short form of mouse KIF17 in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 47545 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5546
- Total vector size (bp) 7027
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKIF17-short
-
Alt nameKinesin 17
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1536
-
MutationG152S*
-
GenBank IDBAE43328.1 AK046890.1
-
Entrez GeneKif17 (a.k.a. 5930435E01Rik, AW492270, Kif17b, mKIAA1405)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG epitope (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CTAGAGAACCCACTGCTTACTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGGCTGATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This vector directs expression of neither of the current mouse RefSeq Kif17 variants, isoform 1 or isoform 2. Rather the vector expresses a cDNA which corresponds to a different alternatively spliced transcript encoding a still shorter isoform of 511 amino acids rather than the 1038 residues of isoform 1 or 710 of isoform 2. The first 400 residues of the “short” isoform are essentially identical to the amino-terminal motor domain of isoform 1 and 2. Based on studies of Kif17 truncations, the short form of mouse Kif17 is predicted to form dimers and to bind microtubules.
*Compared to the reference sequence, this expression vector expresses a protein with substitution of conserved glycine-152 with a serine in the motor domain of Kif17. Due to this mutation, the properties of the produced protein could be altered.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FLAG-KIF17-short-pcDNA3 was a gift from Richard Maurer (Addgene plasmid # 47545 ; http://n2t.net/addgene:47545 ; RRID:Addgene_47545)