Skip to main content

pDD104 (Peft-3::Cre)
(Plasmid #47551)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47551 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCFJ212
  • Backbone size w/o insert (bp) 9539
  • Total vector size (bp) 9929
  • Vector type
    Worm Expression, Cre/Lox
  • Selectable markers
    unc-119(+)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Mach1
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cre Recombinase
  • Alt name
    nCre
  • Promoter eef-1A.1 (eft-3)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCAGTTGGGAAACACTTTGCT
  • 3′ sequencing primer gcttgaaaggattttgcatttatc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The vector backbone, pCFJ212, was received from Addgene. The Cre coding sequence was amplified from pEM3, which was also received from Addgene.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For more information on Goldstein Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Goldstein/

Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDD104 (Peft-3::Cre) was a gift from Bob Goldstein (Addgene plasmid # 47551 ; http://n2t.net/addgene:47551 ; RRID:Addgene_47551)
  • For your References section:

    Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Dickinson DJ, Ward JD, Reiner DJ, Goldstein B. Nat Methods. 2013 Sep 1. doi: 10.1038/nmeth.2641. 10.1038/nmeth.2641 PubMed 23995389