nes714tk/lacZ
(Plasmid
#47614)
-
Purposeused to create transgenic mice expressing LacZ reporter with Nestin enhancer
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 47614 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneSaStk/lacZ
-
Backbone manufacturerClontech; modified by Lendahl lab
-
Modifications to backboneremoved SalI site from pTKbeta and replaced HSV tk promoter with a basic HSV tk promoter containing SalI site.
-
Vector typeenhancer reporter
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenestin 2nd intron fragment
-
Alt nameNES
-
SpeciesH. sapiens (human)
-
Insert Size (bp)714
-
Mutation714 bp from 3' end of 2nd intron
-
Entrez GeneNES (a.k.a. Nbla00170)
- Promoter HSV tk promoter
-
Tags
/ Fusion Proteins
- HSV tk promoter (C terminal on backbone)
- lacZ (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer SaStk/lacZ 5 (gtcggggctggcttaactat)
- 3′ sequencing primer LacZ-R
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
HindIII cleavage excises the complete enhancer-tk promoter-lacZ fragment from the vector. The lacZ gene can be removed from the SaStk/lacZ vector after cleavage with NotI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
nes714tk/lacZ was a gift from Urban Lendahl (Addgene plasmid # 47614 ; http://n2t.net/addgene:47614 ; RRID:Addgene_47614) -
For your References section:
An evolutionarily conserved region in the second intron of the human nestin gene directs gene expression to CNS progenitor cells and to early neural crest cells. Lothian C, Lendahl U. Eur J Neurosci. 1997 Mar;9(3):452-62. 10.1111/j.1460-9568.1997.tb01622.x PubMed 9104587
Map uploaded by the depositor.