Skip to main content
Addgene

pAC-EsaR-D91G-EsaI
(Plasmid #47662)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47662 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAC-EsaR-D91G
  • Backbone size w/o insert (bp) 4511
  • Total vector size (bp) 5332
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    esaI-term
  • Insert Size (bp)
    821
  • GenBank ID
  • Promoter Plac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer tattacgctgatgtccggcctgc
  • 3′ sequencing primer gttgaaggctctcaagggcatcg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    A DNA fragment containing a ribosome binding site, codon-optimized esaI, and transcriptional terminator was commercially synthesized and cloned downstream of esaR between BamHI and SalI in pAC-EsaR-D91G.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

esaI is 636 bp and indicated as lowercase letters in the partial sequence (between BamHI and XhoI sites). Please see pAC-EsaR-D91G for lac promoter and esaR-D91G sequence information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAC-EsaR-D91G-EsaI was a gift from Cynthia Collins (Addgene plasmid # 47662 ; http://n2t.net/addgene:47662 ; RRID:Addgene_47662)
  • For your References section:

    Engineering the esaR Promoter for Tunable Quorum Sensing-Dependent Gene Expression. Shong J, Collins CH. ACS Synth Biol. 2013 Jul 23. 10.1021/sb4000433 PubMed 23879176