This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pDR-AmTrac
(Plasmid #47770)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 47770 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDR GW
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 8200
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AmTrac
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    2229
  • Promoter PMA
  • Tag / Fusion Protein
    • mcpGFP

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer aacaatcgttaataattaattaattgg
  • 3′ sequencing primer gaagtgtcaacaacgtatctacc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDR-AmTrac was a gift from Wolf Frommer (Addgene plasmid # 47770 ; http://n2t.net/addgene:47770 ; RRID:Addgene_47770)
  • For your References section:

    Fluorescent sensors reporting the activity of ammonium transceptors in live cells. De Michele R, Ast C, Loque D, Ho CH, Andrade SL, Lanquar V, Grossmann G, Gehne S, Kumke MU, Frommer WB. Elife. 2013 Jul 2;2:e00800. Print 2013. PubMed 23840931