Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed November 28th & 29th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of November 25th - 29th. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pOTTC476 - pAAV c-fos eYFP
(Plasmid #47907)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 47907 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV CaMKIIa hChR2-EYFP
  • Backbone manufacturer
    Karl Deisseroth
  • Modifications to backbone
    the CaMKIIa promoter and hChR2 ORF were replaced with the promoter and first two exons of c-fos from fosGFP.
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    enhanced Yellow Fluorescent Protein
  • Alt name
    eYFP
  • GenBank ID
  • Promoter c-fos

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (unknown if destroyed)
  • 3′ cloning site NcoI (unknown if destroyed)
  • 5′ sequencing primer c-fos int1 F625 (5'-GGAAGACATAAGCAGTCTCTGACCG )
  • 3′ sequencing primer WPRE_R1 (5'ATGAAAGCCATACGGGAAGC)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    the backbone was obtained from Karl Deiserroth, but is also available from Addgene (Plasmid 26969). the c-fos promoter was obtained from fosGFP (Barth et al, The Journal of Neuroscience, July 21, 2004•24(29):6466 – 6475).
  • Terms and Licenses
  • Article Citing this Plasmid

Depositor Comments

Note that the "N" in the depositor's sequences is legitimately ambiguous in both the Addgene stock and the depositor's original stock. This repeat region may vary in different preps of the plasmid, but it should not affect the plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC476 - pAAV c-fos eYFP was a gift from Brandon Harvey (Addgene plasmid # 47907 ; http://n2t.net/addgene:47907 ; RRID:Addgene_47907)
  • For your References section:

    Near-infrared fluorescent protein iRFP713 as a reporter protein for optogenetic vectors, a transgenic Cre-reporter rat, and other neuronal studies. Richie CT, Whitaker LR, Whitaker KW, Necarsulmer J, Baldwin HA, Zhang Y, Fortuno L, Hinkle JJ, Koivula P, Henderson MJ, Sun W, Wang K, Smith JC, Pickel J, Ji N, Hope BT, Harvey BK. J Neurosci Methods. 2017 Jun 1;284:1-14. doi: 10.1016/j.jneumeth.2017.03.020. Epub 2017 Apr 2. 10.1016/j.jneumeth.2017.03.020 PubMed 28380331