pTrex-Neo-tdTomato
(Plasmid #47975)

• Purpose: Trasgenically expresses tandem tdtomato fluorescent protein in T. cruzi
• Depositing Lab: Rick Tarleton
• Publication: Canavaci et al PLoS Negl Trop Dis. 2010 Jul 13;4(7):e740. doi: 10.1371/journal.pntd.0000740.

Backbone

• Vector backbone: pTrex-Neo
• Backbone manufacturer: Martin P. Vazquez
• Backbone size w/o insert (bp): 6200
• Total vector size (bp): 7700
• Vector type: Trypanasoma cruzi expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: tdTomato
• Alt name: tandem dimer tomato fluorescent protein
• Species: Synthetic; Discosoma sp
• Insert Size (bp): 1463
• Promoter: T. cruzi rRNA

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: SalI (unknown if destroyed)
• 5′ sequencing primer: CGCACGAAAGCGAAATTATTATG
• 3′ sequencing primer: GCAAAAAGGGAAGTGAGCAAAA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Shaner NC
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, Tsien RY. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol. 2004;22:1567–1572

Vazquez MP, Levin MJ (1999) Functional analysis of the intergenic regions of TcP2beta gene loci allowed the construction of an improved Trypanosoma cruzi expression vector. Gene 239: 217–225. doi: 10.1016/S0378-1119(99)00386-8.