Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pTrex-b-NLS-hSpCas9
(Plasmid #62543)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 62543 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTrex-b
  • Backbone manufacturer
    doi:10.1016/S0378-1119(99)00386-8
  • Backbone size w/o insert (bp) 5791
  • Total vector size (bp) 10063
  • Modifications to backbone
    None
  • Vector type
    CRISPR ; Trypanosoma cruzi expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NLS-hSpCas9
  • Insert Size (bp)
    4272
  • Promoter Ribo-HX1
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TTTTCACGCACGAAAGCGAA
  • 3′ sequencing primer CTCCTTCGGCAGGTTGTTCT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    NLS-hSpCas9 insert was subcloned from pX330 from Addgene deposited by Dr Feng Zhang's lab
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTrex-b-NLS-hSpCas9 was a gift from Rick Tarleton (Addgene plasmid # 62543 ; http://n2t.net/addgene:62543 ; RRID:Addgene_62543)
  • For your References section:

    CRISPR-Cas9-Mediated Single-Gene and Gene Family Disruption in Trypanosoma cruzi. Peng D, Kurup SP, Yao PY, Minning TA, Tarleton RL. MBio. 2014 Dec 30;6(1). pii: e02097-14. doi: 10.1128/mBio.02097-14. 10.1128/mBio.02097-14 PubMed 25550322