pTrex-n-eGFP
(Plasmid #62544)

• Purpose: Expression of eGFP in T. cruzi. The NheI-linearized form of this plasmid could be efficiently integrated in to T. cruzi genome
• Depositing Lab: Rick Tarleton
• Publication: Peng et al MBio. 2014 Dec 30;6(1). pii: e02097-14. doi: 10.1128/mBio.02097-14.

Backbone

• Vector backbone: pTrex-n
• Backbone manufacturer: http://dx.doi.org/10.1016/S0378-1119(99)00386-8
• Backbone size w/o insert (bp): 6196
• Total vector size (bp): 6916
• Vector type: (1)Trypanosoma cruzi expression of eGFP (2) genome integration of eGFP
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: eGFP
• Insert Size (bp): 720
• Mutation: None
• Promoter: Ribo-HX1
• Tag / Fusion Protein:
  • None

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TTTTCACGCACGAAAGCGAA
• 3′ sequencing primer: CTCCTTCGGCAGGTTGTTCT

Resource Information

• Supplemental Documents:
  • GenBank annotation file
• A portion of this plasmid was derived from a plasmid made by: eGFP gene was subcloned from pTD4-eGFP plasmid. pTD4-eGFP plasmid was a gift from Gretchen Cooley in Dr Rick Tarleton's lab at University of Georgia
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry