-
PurposeExpression of eGFP in T. cruzi. The NheI-linearized form of this plasmid could be efficiently integrated in to T. cruzi genome
-
Depositing Lab
-
Depositing OrganizationUniversity of Georgia
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62544 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
| DNA | 62544-D50 | 50 μg of DNA in Tris buffer | $495 * | ||
| DNA | 62544-D100 | 100 μg of DNA in Tris buffer | $585 * | ||
* Log in to view industry pricing.
Backbone
-
Vector backbonepTrex-n
-
Backbone manufacturerhttp://dx.doi.org/10.1016/S0378-1119(99)00386-8
- Backbone size w/o insert (bp) 6196
- Total vector size (bp) 6916
-
Vector type(1)Trypanosoma cruzi expression of eGFP (2) genome integration of eGFP
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
Insert Size (bp)720
-
MutationNone
- Promoter Ribo-HX1
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TTTTCACGCACGAAAGCGAA
- 3′ sequencing primer CTCCTTCGGCAGGTTGTTCT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byeGFP gene was subcloned from pTD4-eGFP plasmid. pTD4-eGFP plasmid was a gift from Gretchen Cooley in Dr Rick Tarleton's lab at University of Georgia
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 62544-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 62544-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTrex-n-eGFP was a gift from Rick Tarleton (Addgene plasmid # 62544 ; http://n2t.net/addgene:62544 ; RRID:Addgene_62544) -
For your References section:
CRISPR-Cas9-Mediated Single-Gene and Gene Family Disruption in Trypanosoma cruzi. Peng D, Kurup SP, Yao PY, Minning TA, Tarleton RL. MBio. 2014 Dec 30;6(1). pii: e02097-14. doi: 10.1128/mBio.02097-14. 10.1128/mBio.02097-14 PubMed 25550322