-
PurposeExpression of eGFP in T. cruzi. The NheI-linearized form of this plasmid could be efficiently integrated in to T. cruzi genome
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62544 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTrex-n
-
Backbone manufacturerhttp://dx.doi.org/10.1016/S0378-1119(99)00386-8
- Backbone size w/o insert (bp) 6196
- Total vector size (bp) 6916
-
Vector type(1)Trypanosoma cruzi expression of eGFP (2) genome integration of eGFP
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
Insert Size (bp)720
-
MutationNone
- Promoter Ribo-HX1
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TTTTCACGCACGAAAGCGAA
- 3′ sequencing primer CTCCTTCGGCAGGTTGTTCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byeGFP gene was subcloned from pTD4-eGFP plasmid. pTD4-eGFP plasmid was a gift from Gretchen Cooley in Dr Rick Tarleton's lab at University of Georgia
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTrex-n-eGFP was a gift from Rick Tarleton (Addgene plasmid # 62544 ; http://n2t.net/addgene:62544 ; RRID:Addgene_62544) -
For your References section:
CRISPR-Cas9-Mediated Single-Gene and Gene Family Disruption in Trypanosoma cruzi. Peng D, Kurup SP, Yao PY, Minning TA, Tarleton RL. MBio. 2014 Dec 30;6(1). pii: e02097-14. doi: 10.1128/mBio.02097-14. 10.1128/mBio.02097-14 PubMed 25550322