Skip to main content

Gal1/10 His6-MBP TEV Trp S. cerevisiae expression vector (12TRP-C)
(Plasmid #48302)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 48302 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRS424
  • Backbone size (bp) 7773
  • Vector type
    NA
  • Tags / Fusion Proteins
    • His6 (N terminal on backbone)
    • MBP (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function.

This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.

This vector has a TEV cleavable His6-MBP tag on the N-terminus and can complement Trp auxotrophy.

Add the following tags to your PCR primers:
LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG)
LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA

Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.

Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-).

For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Gal1/10 His6-MBP TEV Trp S. cerevisiae expression vector (12TRP-C) was a gift from Scott Gradia (Addgene plasmid # 48302 ; http://n2t.net/addgene:48302 ; RRID:Addgene_48302)