Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pDS66
(Plasmid #48364)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 48364 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEM-T Easy
  • Backbone manufacturer
    Promega
  • Total vector size (bp) 4500
  • Vector type
    Cre/Lox ; Knockout in T. Brucei
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    3XHA-intergenic region of TUB-HYG (modified from PMID 16269191)
  • Species
    T. brucei

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer tb#44 CTGGTTAGTATGGACTTCTCTAGA
  • 3′ sequencing primer pBRrevBam
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For additional information, see http://tryps.rockefeller.edu/trypsru2_cre-lox.html

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDS66 was a gift from George Cross (Addgene plasmid # 48364 ; http://n2t.net/addgene:48364 ; RRID:Addgene_48364)
  • For your References section:

    Strategies to construct null and conditional null Trypanosoma brucei mutants using Cre-recombinase and loxP. Kim HS, Li Z, Boothroyd C, Cross GA. Mol Biochem Parasitol. 2013 Aug 13;191(1):16-19. doi: 10.1016/j.molbiopara.2013.08.001. 10.1016/j.molbiopara.2013.08.001 PubMed 23954366