Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #48355)


Item Catalog # Description Quantity Price (USD)
Plasmid 48355 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Cross Lab
  • Total vector size (bp) 7015
  • Vector type
    Cre/Lox ; Knockout in T. Brucei
  • Selectable markers
    Hygromycin ; Gancyclovir

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    loxP-SAS-HYG-Ty1-TK-loxP flanked by TbMCM-BP-targeting homologies
  • Species
    T. brucei

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer tb#44 CTGGTTAGTATGGACTTCTCTAGA
  • 3′ sequencing primer pBRrevBam
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

For additional information, see

Addgene's sequence with primer Hygro-R shows several mismatches within the TbMCM-BP 5' homology arm as well as other small changes compared to the depositor's reference sequence. These changes should not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSY45 was a gift from George Cross (Addgene plasmid # 48355 ; ; RRID:Addgene_48355)
  • For your References section:

    Strategies to construct null and conditional null Trypanosoma brucei mutants using Cre-recombinase and loxP. Kim HS, Li Z, Boothroyd C, Cross GA. Mol Biochem Parasitol. 2013 Aug 13;191(1):16-19. doi: 10.1016/j.molbiopara.2013.08.001. 10.1016/j.molbiopara.2013.08.001 PubMed 23954366