pSY45
(Plasmid
#48355)
-
PurposeTargets TbMCM-BP for Cre-lox mediated knockout in T. brucei
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 48355 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepyrFEKO-HYG
-
Backbone manufacturerCross Lab
- Total vector size (bp) 7015
-
Vector typeCre/Lox ; Knockout in T. Brucei
-
Selectable markersHygromycin ; Gancyclovir
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameloxP-SAS-HYG-Ty1-TK-loxP flanked by TbMCM-BP-targeting homologies
-
SpeciesT. brucei
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tb#44 CTGGTTAGTATGGACTTCTCTAGA
- 3′ sequencing primer pBRrevBam (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For additional information, see http://tryps.rockefeller.edu/trypsru2_cre-lox.html
Addgene's sequence with primer Hygro-R shows several mismatches within the TbMCM-BP 5' homology arm as well as other small changes compared to the depositor's reference sequence. These changes should not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSY45 was a gift from George Cross (Addgene plasmid # 48355 ; http://n2t.net/addgene:48355 ; RRID:Addgene_48355) -
For your References section:
Strategies to construct null and conditional null Trypanosoma brucei mutants using Cre-recombinase and loxP. Kim HS, Li Z, Boothroyd C, Cross GA. Mol Biochem Parasitol. 2013 Aug 13;191(1):16-19. doi: 10.1016/j.molbiopara.2013.08.001. 10.1016/j.molbiopara.2013.08.001 PubMed 23954366