pCAG-T3-hCAS-pA
(Plasmid #48625)

• Purpose: Expresses CAS9 nuclease in mammalian cells. Used to modify genome of mouse embroys
• Depositing Labs: Wataru Fujii, Kunihiko Naito
• Publication: Fujii et al Nucleic Acids Res. 2013 Aug 30.

Backbone

• Vector backbone: pCAGGS
• Total vector size (bp): 9293
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Codon optimized Cas9
• Alt name: hCAS9
• Alt name: T3-FLAG-NLS-CAS9-NLS-polyA
• Species: Synthetic
• Insert Size (bp): 4218
• Promoter: CAG promoter
• Tags / Fusion Proteins:
  • FLAG (N terminal on insert)
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)
  • polyA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGTCCCCTTCTCCCTCTC
• 3′ sequencing primer: ATTTTTGGCAGAGGGAAAAAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The human codon-optimized hCas9 insert in this vector was amplified from plasmid hCas9 (George Church; Addgene #41815).
• Articles Citing this Plasmid:
  • 20 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

SV40 nuclear localization signals (NLS) were added to the N- and C-terminus of Cas9 by PCR using NLS-coding primers. The NLS flanked Cas9 was inserted into the BglII-Acc65I site of ZFN-platform vector to add a T3 promoter, FLAG-tag and the Tbpl1 3′UTR containing a 95 bp polyA tail. The sequence from the T3 promoter to the polyA tail was cloned by PCR and inserted into the EcoRI site of the pCAGGS vector.

For the in vitro synthesis of CAS9 mRNAs, the vector was linearized by SphI and in-vitro transcribed using T3-RNA-polymerase (Promega) in the presence of m7G(5′)ppp(5′)G to synthesize capped RNA.

The Tbpl1 3′UTR 95 nucleotide polyA tail at the 3' end of the insert allows in vitro transcribed mRNA from this plasmid to be used directly for microinjection into animal embryos or oocytes without additional polyadenylation treatment.

The CAG promoter in this plasmid also allows it to be used as a CAS9-expression vector.