-
PurposeExpress human AQP9, which induces filopodia formation
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 48808 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 5610
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAQP9
-
Alt nameAquaporin 9
-
SpeciesH. sapiens (human)
-
Insert Size (bp)888
-
GenBank IDNM_020980
-
Entrez GeneAQP9 (a.k.a. AQP-9, HsT17287, SSC1, T17287)
-
Tag
/ Fusion Protein
- eGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer atcacatggtcctgctggag (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-AQP9 was a gift from Kenneth Jacobson & Vesa Loitto (Addgene plasmid # 48808 ; http://n2t.net/addgene:48808 ; RRID:Addgene_48808) -
For your References section:
Filopodia are induced by aquaporin-9 expression. Loitto VM, Huang C, Sigal YJ, Jacobson K. Exp Cell Res. 2007 Apr 15;313(7):1295-306. Epub 2007 Feb 8. 10.1016/j.yexcr.2007.01.023 PubMed 17346701