Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGFP-AQP9
(Plasmid #48808)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 48808 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 5610
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AQP9
  • Alt name
    Aquaporin 9
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    888
  • GenBank ID
    NM_020980
  • Entrez Gene
    AQP9 (a.k.a. AQP-9, HsT17287, SSC1, T17287)
  • Tag / Fusion Protein
    • eGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer atcacatggtcctgctggag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-AQP9 was a gift from Kenneth Jacobson & Vesa Loitto (Addgene plasmid # 48808 ; http://n2t.net/addgene:48808 ; RRID:Addgene_48808)
  • For your References section:

    Filopodia are induced by aquaporin-9 expression. Loitto VM, Huang C, Sigal YJ, Jacobson K. Exp Cell Res. 2007 Apr 15;313(7):1295-306. Epub 2007 Feb 8. 10.1016/j.yexcr.2007.01.023 PubMed 17346701