Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

peft-3::cas-9::tbb-2 3'UTR
(Plasmid #48960)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 48960 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDEST
  • Backbone manufacturer
    life technologies
  • Backbone size w/o insert (bp) 4959
  • Total vector size (bp) 8732
  • Modifications to backbone
    a unc-54 3'UTR was cloned to the initial pDEST vector
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    cas9
  • Promoter eef-1A.1 (eft-3)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TGCTCActccgtagcagcc
  • 3′ sequencing primer aagaaagaagagtgatagagaagaaggg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    peft-3::cas-9::tbb-2 3'UTR was a gift from Mario de Bono (Addgene plasmid # 48960 ; http://n2t.net/addgene:48960 ; RRID:Addgene_48960)
  • For your References section:

    Efficient genome editing in Caenorhabditis elegans by CRISPR-targeted homologous recombination. Chen C, Fenk LA, de Bono M. Nucleic Acids Res. 2013 Sep 5. 10.1093/nar/gkt805 PubMed 24013562