Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
As of April 1, 2023, we increased some of our prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCCM935
(Plasmid #58202)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 58202 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCR-Blunt II-TOPO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 3519
  • Total vector size (bp) 4359
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    unc-22 sgRNA
  • Alt name
    unc-22 guide
  • Species
    C. elegans (nematode)
  • Promoter U6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA target sequence GAACCCGTTGCCGAATACAC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCCM935 was a gift from Craig Mello (Addgene plasmid # 58202 ; http://n2t.net/addgene:58202 ; RRID:Addgene_58202)
  • For your References section:

    A Co-CRISPR Strategy for Efficient Genome Editing in Caenorhabditis elegans. Kim H, Ishidate T, Ghanta KS, Seth M, Conte D Jr, Shirayama M, Mello CC. Genetics. 2014 May 30. pii: genetics.114.166389. 10.1534/genetics.114.166389 PubMed 24879462