Skip to main content

EMM67
(Plasmid #49043)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49043 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    unknown
  • Backbone manufacturer
    Joung Lab
  • Backbone size (bp) 8500
  • Modifications to backbone
    Replaced p65 with LSD1
  • Vector type
    Mammalian Expression ; TALE LSD1 Expression Vector
  • Promoter EF1 alpha
  • Tag / Fusion Protein
    • LSD1 (N terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ATGACGCAGTTCGGGATGAG
  • 3′ sequencing primer TTCGGGAATACGGCGATTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EMM67 was a gift from Bradley Bernstein & Eric Mendenhall (Addgene plasmid # 49043 ; http://n2t.net/addgene:49043 ; RRID:Addgene_49043)
  • For your References section:

    Locus-specific editing of histone modifications at endogenous enhancers. Mendenhall EM, Williamson KE, Reyon D, Zou JY, Ram O, Joung JK, Bernstein BE. Nat Biotechnol. 2013 Sep 8. doi: 10.1038/nbt.2701. 10.1038/nbt.2701 PubMed 24013198