Skip to main content
Addgene

AAV-GFP/Cre
(Plasmid #49056)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49056 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    adeno-associated viral (AAVsp)
  • Backbone size w/o insert (bp) 6165
  • Total vector size (bp) 8002
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cre
  • Alt name
    GFP-NLS-Cre
  • Alt name
    green fluorescent protein Cre recombinase (GFP/Cre) fusion protein
  • Species
    M. musculus (mouse); Aequorea victoria green
  • Insert Size (bp)
    1837
  • Promoter CMV
  • Tags / Fusion Proteins
    • EGFP (N terminal on insert)
    • Myc (N terminal on insert)
    • NLS (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmlI (destroyed during cloning)
  • 3′ cloning site XhoI (destroyed during cloning)
  • 5′ sequencing primer tagccacaccagccaccact
  • 3′ sequencing primer caacgtgctggtctgtgtg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Encodes an N-terminal GFP, Myc-tag fused in-frame to an SV40 nuclear localization signal (NLS) and Cre recombinase (AAV-GFP/Cre).

Expression is driven by a CMV promoter with a splice donor/acceptor sequence (SD/SA) and flanked by inverted terminal repeats (ITRs). High titer, purified virus prepared from this plasmid can be used for stereotaxic injection into adult ROSA26 reporter mice.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-GFP/Cre was a gift from Fred Gage (Addgene plasmid # 49056 ; http://n2t.net/addgene:49056 ; RRID:Addgene_49056)
  • For your References section:

    Adeno-associated virus effectively mediates conditional gene modification in the brain. Kaspar BK, Vissel B, Bengoechea T, Crone S, Randolph-Moore L, Muller R, Brandon EP, Schaffer D, Verma IM, Lee KF, Heinemann SF, Gage FH. Proc Natl Acad Sci U S A. 2002 Feb 19;99(4):2320-5. Epub 2002 Feb 12. 10.1073/pnas.042678699 PubMed 11842206