pMT3-FLAG-KLF3
(Plasmid
#49102)
-
PurposeExpresses KLF3 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49102 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMT3
- Backbone size w/o insert (bp) 5100
- Total vector size (bp) 1035
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKrüppel-Like Factor 3(KLF3)
-
Alt nameBKLF
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1035
-
GenBank IDNC_000071.6
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GACAATGACATCCACTTTGC
- 3′ sequencing primer CGTCAAGTTTGGCGCGAAAT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMT3-FLAG-KLF3 was a gift from Merlin Crossley (Addgene plasmid # 49102 ; http://n2t.net/addgene:49102 ; RRID:Addgene_49102) -
For your References section:
KLF3 regulates muscle-specific gene expression and synergizes with serum response factor on KLF binding sites. Himeda CL, Ranish JA, Pearson RC, Crossley M, Hauschka SD. Mol Cell Biol. 2010 Jul;30(14):3430-43. doi: 10.1128/MCB.00302-10. Epub 2010 Apr 19. 10.1128/MCB.00302-10 PubMed 20404088