ptdTomato-N1-FLCN
(Plasmid
#49174)
-
PurposeMammalian expression of mouse folliculin (FLCN) fused to tdTomato
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49174 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneptdTomato-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 7178
-
Modifications to backboneNone
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFolliculin
-
Alt nameFLCN
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1737
-
MutationStop codon deleted
-
GenBank IDNM_146018.2
-
Entrez GeneFlcn (a.k.a. B430214A04Rik, Bhd, FLCL)
- Promoter CMV
-
Tag
/ Fusion Protein
- tdTomato (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer catggtggcgaccggtggatcc (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ptdTomato-N1-FLCN was a gift from Shawn Ferguson (Addgene plasmid # 49174 ; http://n2t.net/addgene:49174 ; RRID:Addgene_49174) -
For your References section:
Recruitment of folliculin to lysosomes supports the amino acid-dependent activation of Rag GTPases. Petit CS, Roczniak-Ferguson A, Ferguson SM. J Cell Biol. 2013 Sep 30;202(7):1107-1122. 10.1083/jcb.201307084 PubMed 24081491