Skip to main content
Addgene

pWPT-ACC/ACC/ACC-mEGFP-IRES-mCherry
(Plasmid #49228)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49228 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Plasmid 12255: pWPT-GFP
  • Backbone size w/o insert (bp) 8754
  • Total vector size (bp) 10753
  • Modifications to backbone
    1. PCRed WPRE and ligated into XhoI site upstream of EF1-short and EcoRI site on 3' end of WPRE (EF1-short segment deleted. EcoRI site on 3' end of WPRE eliminated by ligation with MfeI on PCR product. WPRE sequence unaltered. WPRE PCRed and re-entered into vector to create unique XhoI, EcoRI, NotI sites on the 5' end of WPRE and to eliminate BamHI site). 2. EF1-short PCRed and ligated to XhoI and EcoRI sites on 5' end of WPRE. Original XhoI site upstream of EF1-short eliminated via ligation to SalI site on PCR product. Sites now between EF1 and WPRE are XhoI, BamHI, EcoRI, NotI. 3. The translation control elements, mEGFP, IRES, and mCherry segment from the corresponding pCur5-XX-mEGFP-IRES-mCherry was ligated into the pWPT-EF1short-WPRE backbone via XhoI and NotI sites.
  • Vector type
    Mammalian Expression, Lentiviral, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mEGFP
  • Species
    Synthetic
  • Insert Size (bp)
    732
  • Promoter EF1-short
  • Tag / Fusion Protein
    • SfuI site to create C-terminal fusions (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site SfuI (not destroyed)
  • 5′ sequencing primer ccgagggtgggggagaac (5 to 3)
  • 3′ sequencing primer AGGGCGAGGGCGATGCCACCTA (5' to 3')
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    711
  • Promoter EF1-short

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GTCACCTTCAGCTTGGCGG (5' to 3')
  • 3′ sequencing primer CATTAAAGCAGCGTATCC (5 to 3)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Vector allows for control of transgene expression at the level of translation. It is 1 vector in a set of 9 that spans a range of expression levels. Sequencing through any part of the IRES sequence is not advised. Expression of gene downstream of IRES remains constant, despite varying expression of gene upstream.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWPT-ACC/ACC/ACC-mEGFP-IRES-mCherry was a gift from Clifford Wang (Addgene plasmid # 49228 ; http://n2t.net/addgene:49228 ; RRID:Addgene_49228)
  • For your References section:

    Tuning gene expression with synthetic upstream open reading frames. Ferreira JP, Overton KW, Wang CL. Proc Natl Acad Sci U S A. 2013 Jul 9;110(28):11284-9. doi: 10.1073/pnas.1305590110. Epub 2013 Jun 24. 10.1073/pnas.1305590110 PubMed 23798422