-
PurposeExpresses sgRNA targeting yellow gene and Cas9-Puro in Drosophila S2 cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49331 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAc-STABLE1-Puro
-
Backbone manufacturerDr. James Sutherland
- Backbone size w/o insert (bp) 6600
- Total vector size (bp) 10658
-
Vector typeInsect Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameCas9
-
Alt nameCRISPR associated 9
-
Alt namehspCas9
-
SpeciesSynthetic; Streptococcus pyogenes
-
Insert Size (bp)4278
-
MutationHuman codon optimised
- Promoter Actin-5c
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- NLS (N terminal on insert)
- NLS (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer gagttcttgtgctgtgtgga
- 3′ sequencing primer tcgagacaaacggcgaaacc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namedU6-sgRNA
-
SpeciesD. melanogaster (fly), Synthetic
-
Insert Size (bp)500
- Promoter Drosophila U6
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer GTTCGACTTGCAGCCTGAAATACG
- 3′ sequencing primer AAAAAAGCACCGACTCGGTGC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namey1 sgRNA
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)20
-
Entrez Geney (a.k.a. Dmel_CG3757, CG3757, Dmel\CG3757, EG:125H10.2, T6, Y)
- Promoter Drosophila U6
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site BspQI (destroyed during cloning)
- 3′ cloning site BspQI (destroyed during cloning)
- 5′ sequencing primer GTTCGACTTGCAGCCTGAAATACG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe human codon optimised spCas9 gene was amplified from pX330 (Addgene plasmid 42230) deposited by Feng Zhang. The pAc-STABLE1-Puro plasmid was obtained from Dr James Sutherland.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA target sequence GGTTTTGGACACTGGAACCG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAc-y1sgRNA-Cas9 was a gift from Ji-Long Liu (Addgene plasmid # 49331 ; http://n2t.net/addgene:49331 ; RRID:Addgene_49331) -
For your References section:
Mutagenesis and homologous recombination in Drosophila cell lines using CRISPR/Cas9. Bassett AR, Tibbit C, Ponting CP, Liu JL. Biol Open. 2013 Dec 10. pii: bio.20137120v1. doi: 10.1242/bio.20137120. 10.1242/bio.20137120 PubMed 24326186