pmirGLO-Smad4-1719
(Plasmid
#49383)
-
PurposeInsert is a fragment of the Smad4 3'-UTR that contains miR-17 and miR-19 binding sites. To be used for 3'UTR assay.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49383 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepmirGLO
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 7350
- Total vector size (bp) 7368
-
Modifications to backboneFor cloning oligonucleotides into pmirGLO, bp 7314-7331 were excised (region between PmeI and XbaI).
-
Vector typeLuciferase
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsN/A
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSmad family member 4
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)36
-
GenBank IDNM_005359.5
-
Entrez GeneSMAD4 (a.k.a. DPC4, JIP, MADH4, MYHRS)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PmeI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GAAGCTGAGTTGGCTGCT
- 3′ sequencing primer CACTGCATTCTAGTTGTGGT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmirGLO-Smad4-1719 was a gift from Martine Roussel (Addgene plasmid # 49383 ; http://n2t.net/addgene:49383 ; RRID:Addgene_49383) -
For your References section:
Silencing of the miR-17~92 cluster family inhibits medulloblastoma progression. Murphy BL, Obad S, Bihannic L, Ayrault O, Zindy F, Kauppinen S, Roussel MF. Cancer Res. 2013 Oct 21. 10.1158/0008-5472.CAN-13-0927 PubMed 24145352