EGFP-Rab10N122I
(Plasmid
#49546)
-
Purposeexpresses EGFP-Rab10N122I (no nucleotide mutant) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49546 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneEGFP C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5300
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRab10N122I
-
SpeciesH. sapiens (human)
-
Insert Size (bp)600
-
MutationAsparagine 122 to Isoleucine
-
GenBank IDAF498945
-
Entrez GeneRAB10
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI/BglII (destroyed during cloning)
- 3′ cloning site XhoI/SalI (destroyed during cloning)
- 5′ sequencing primer EGFP C (CATGGTCCTGCTGGAGTTCGTG) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byRab10 cDNA derived from pCDNA3.1-Rab10 purchased from Missouri S&T cDNA Resource Center
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-Rab10N122I was a gift from Marci Scidmore (Addgene plasmid # 49546) -
For your References section:
The Anaplasma phagocytophilum-occupied vacuole selectively recruits Rab-GTPases that are predominantly associated with recycling endosomes. Huang B, Hubber A, McDonough JA, Roy CR, Scidmore MA, Carlyon JA. Cell Microbiol. 2010 Sep 1;12(9):1292-307. doi: 10.1111/j.1462-5822.2010.01468.x. Epub 2010 Mar 25. 10.1111/j.1462-5822.2010.01468.x PubMed 20345488