Skip to main content
Addgene

pJB042 (FtsZ-mEos2)
(Plasmid #49764)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49764 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCA24N
  • Backbone manufacturer
    NBRP-E.coli at NIG
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 6300
  • Modifications to backbone
    replaced N-terminal 6xHis with novel SpeI site, results in 6bp reduced expression
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For fluorescence studies, grow at RT or 30C.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FtsZ-mEos2
  • Species
    E. coli
  • Insert Size (bp)
    1865
  • Promoter T5-lac
  • Tag / Fusion Protein
    • mEos2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GCGTAATAGCGAAGAGGCCCG
  • 3′ sequencing primer cattactggatctatcaacaggag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJB042 (FtsZ-mEos2) was a gift from Jie Xiao (Addgene plasmid # 49764 ; http://n2t.net/addgene:49764 ; RRID:Addgene_49764)
  • For your References section:

    In vivo organization of the FtsZ-ring by ZapA and ZapB revealed by quantitative super-resolution microscopy. Buss J, Coltharp C, Huang T, Pohlmeyer C, Wang SC, Hatem C, Xiao J. Mol Microbiol. 2013 Sep;89(6):1099-120. doi: 10.1111/mmi.12331. Epub 2013 Aug 14. 10.1111/mmi.12331 PubMed 23859153