-
PurposeInducible expression of FtsZ-mEos2 in bacteria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49764 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCA24N
-
Backbone manufacturerNBRP-E.coli at NIG
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 6300
-
Modifications to backbonereplaced N-terminal 6xHis with novel SpeI site, results in 6bp reduced expression
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor fluorescence studies, grow at RT or 30C.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFtsZ-mEos2
-
SpeciesE. coli
-
Insert Size (bp)1865
- Promoter T5-lac
-
Tag
/ Fusion Protein
- mEos2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GCGTAATAGCGAAGAGGCCCG
- 3′ sequencing primer cattactggatctatcaacaggag (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJB042 (FtsZ-mEos2) was a gift from Jie Xiao (Addgene plasmid # 49764 ; http://n2t.net/addgene:49764 ; RRID:Addgene_49764) -
For your References section:
In vivo organization of the FtsZ-ring by ZapA and ZapB revealed by quantitative super-resolution microscopy. Buss J, Coltharp C, Huang T, Pohlmeyer C, Wang SC, Hatem C, Xiao J. Mol Microbiol. 2013 Sep;89(6):1099-120. doi: 10.1111/mmi.12331. Epub 2013 Aug 14. 10.1111/mmi.12331 PubMed 23859153