-
PurposeIn vivo GFP based system to measure break induced replication (BIR) repair efficiency. expression of I-SceI generates a double strand break that when repaired by BIR mechanism will restore GFP.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49807 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepgkPURO
-
Modifications to backboneGFP-IsceI: 2037-2576; IsceI: 2577-2594; puromycin: 3858-3260; iGFP: 5750-5169; poly-A signal: 5015-4981
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP
- Promoter beta-actin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site bbsI (not destroyed)
- 3′ cloning site aflII (not destroyed)
- 5′ sequencing primer gatcaggcagagcaggaacctg
- 3′ sequencing primer cctgaagaacgagatcagcagcctctgt (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBIR-GFP was a gift from Thanos Halazonetis (Addgene plasmid # 49807 ; http://n2t.net/addgene:49807 ; RRID:Addgene_49807)