GBK-Rab6AΔT27NCSC
(Plasmid
#49836)
-
Purposeexpresses GAL4BD-Rab6AΔT27NCSC in yeast
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49836 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneGBK-T7
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 7300
- Total vector size (bp) 7900
-
Vector typeYeast Expression
-
Selectable markersNeomycin (select with G418), TRP1
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRab6A
-
Alt nameRab6A isoform b
-
SpeciesH. sapiens (human)
-
Insert Size (bp)600
-
Mutationthreonine 27 to asparagine; deleted cysteine 206, serine 207, cysteine 208
-
GenBank ID
-
Entrez GeneRAB6A (a.k.a. RAB6)
- Promoter ADHI
-
Tags
/ Fusion Proteins
- Gal4 Binding Domain (N terminal on insert)
- Myc (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI/SalI (destroyed during cloning)
- 5′ sequencing primer T7 (TAATACGACTCACTATAGGG) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byRab6A cDNA derived from pCDNA3.1+Rab6A purchased from Missouri S&T cDNA Resource Center
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GBK-Rab6AΔT27NCSC was a gift from Marci Scidmore (Addgene plasmid # 49836)
Map uploaded by the depositor.
