-
PurposeIntegrating vector with an improved Red-shifted Thermostable Firefly Luciferase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49997 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMV306
- Backbone size w/o insert (bp) 3995
- Total vector size (bp) 6071
-
Vector typeBacterial Expression ; Mycobacteria integrating vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameG13 promoter + Firefly luciferase Red Thermostable
-
Alt nameFFlucRT
-
Alt nameluc
-
SpeciesMycobacterium marinum + Photinus pyralis
-
Insert Size (bp)2155
-
MutationCodon optimized for Mycobacterium tuberculosis with mutations to red-shift: Ile423Leu, Asp436Gly, Leu530Arg, Ser284Thr, Thr214Ala, Ala215Leu, Ile232Ala, Phe295Leu, and Glu354Lys
-
GenBank IDKC688279
- Promoter G13 from M. marinum
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer aaccgtattaccgcctttga (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that there are some discrepancies between Addgene's quality control sequence and the depositor's assembled full sequence. The Robertson lab reports that these differences will not affect the function of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMV306G13+FFlucRT was a gift from Brian Robertson (Addgene plasmid # 49997 ; http://n2t.net/addgene:49997 ; RRID:Addgene_49997) -
For your References section:
Rapid in vivo assessment of drug efficacy against Mycobacterium tuberculosis using an improved firefly luciferase. Andreu N, Zelmer A, Sampson SL, Ikeh M, Bancroft GJ, Schaible UE, Wiles S, Robertson BD. J Antimicrob Chemother. 2013 Sep;68(9):2118-27. doi: 10.1093/jac/dkt155. Epub 2013 Apr 30. 10.1093/jac/dkt155 PubMed 23633686