-
PurposeIntegrase removed to increase stability of the plasmid in mycobacteria
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49999 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMV306hsp
- Backbone size w/o insert (bp) 6186
- Total vector size (bp) 9507
-
Modifications to backboneIntegrase gene removed by inverse PCR.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameBacterial luciferase operon + G13 promoter
-
Alt nameLuxABCDE
-
SpeciesMycobacterium marinum + Photorhabdus luminescens
-
Insert Size (bp)6186
-
MutationIt contains a gram-positive enhanced translation signal in front of luxA, luxC and luxe. G13 promoter cloned in front of luxC
- Promoter G13 from M. marinum G13 promoter driving luxC
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer agaataacgttggcactcgc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGenes were cloned from vector pSB2025 obtained from Dr. Phil Hill at Nottingham University.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The sequence of the Lux operon is theoretical. As such, there are a few differences between Addgene sequence and full plasmid sequence. These differences do not affect plasmid function.
Qazi, S.N., et al., agr expression precedes escape of internalized Staphylococcus aureus from the host endosome. Infect Immun, 2001. 69(11): p. 7074-82.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMV306DIhsp+LuxG13 was a gift from Brian Robertson (Addgene plasmid # 49999 ; http://n2t.net/addgene:49999 ; RRID:Addgene_49999) -
For your References section:
Rapid in vivo assessment of drug efficacy against Mycobacterium tuberculosis using an improved firefly luciferase. Andreu N, Zelmer A, Sampson SL, Ikeh M, Bancroft GJ, Schaible UE, Wiles S, Robertson BD. J Antimicrob Chemother. 2013 Sep;68(9):2118-27. doi: 10.1093/jac/dkt155. Epub 2013 Apr 30. 10.1093/jac/dkt155 PubMed 23633686