pUV15-pHGFP
(Plasmid #70045)

• Purpose: encodes a pH-sensitive ratiometric GFP (pH-GFP), which allows for noninvasive measurements of intrabacterial pH in live cells
• Depositing Lab: Sabine Ehrt
• Publication: Vandal et al Nat Med. 2008 Aug;14(8):849-54. doi: 10.1038/nm.1795. Epub 2008 Jul 20.

Backbone

• Vector backbone: unknown
• Vector type: Mycobacterium tuberculosis expression vector

Growth in Bacteria

• Bacterial Resistance(s): Hygromycin, 200 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: phGFP
• Alt name: pH-sensitive ratiometric GFP
• Species: Synthetic
• Insert Size (bp): 700
• Promoter: mycobacterial promoter Psmyc

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (not destroyed)
• 3′ cloning site: EcoRV (not destroyed)
• 5′ sequencing primer: psmyc1 CGACCAGCACGGCATACATC
• 3′ sequencing primer: pBluescript-KS

Resource Information

• Supplemental Documents:
  • pUV15-pHGFP genbank
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The pH-GFP insert in this plasmid contains a F220L mutation compared to the wild-type pHluorin. This difference does not affect function of the pH-GFP.