Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #70045)


Item Catalog # Description Quantity Price (USD)
Plasmid 70045 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Alt name
    pH-sensitive ratiometric GFP
  • Species
  • Insert Size (bp)
  • Promoter mycobacterial promoter Psmyc

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer psmyc1 CGACCAGCACGGCATACATC
  • 3′ sequencing primer pBluescript-KS
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The pH-GFP insert in this plasmid contains a F220L mutation compared to the wild-type pHluorin. This difference does not affect function of the pH-GFP.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUV15-pHGFP was a gift from Sabine Ehrt (Addgene plasmid # 70045 ; ; RRID:Addgene_70045)
  • For your References section:

    A membrane protein preserves intrabacterial pH in intraphagosomal Mycobacterium tuberculosis. Vandal OH, Pierini LM, Schnappinger D, Nathan CF, Ehrt S. Nat Med. 2008 Aug;14(8):849-54. doi: 10.1038/nm.1795. Epub 2008 Jul 20. 10.1038/nm.1795 PubMed 18641659