-
Purposeencodes a pH-sensitive ratiometric GFP (pH-GFP), which allows for noninvasive measurements of intrabacterial pH in live cells
-
Depositing Lab
-
Depositing OrganizationCornell University
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 70045 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 70045-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 70045-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneunknown
-
Vector typeMycobacterium tuberculosis expression vector
Growth in Bacteria
-
Bacterial Resistance(s)Hygromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namephGFP
-
Alt namepH-sensitive ratiometric GFP
-
SpeciesSynthetic
-
Insert Size (bp)700
- Promoter mycobacterial promoter Psmyc
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer psmyc1 CGACCAGCACGGCATACATC
- 3′ sequencing primer pBluescript-KS
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The pH-GFP insert in this plasmid contains a F220L mutation compared to the wild-type pHluorin. This difference does not affect function of the pH-GFP.
DNA (Catalog # 70045-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 70045-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUV15-pHGFP was a gift from Sabine Ehrt (Addgene plasmid # 70045 ; http://n2t.net/addgene:70045 ; RRID:Addgene_70045) -
For your References section:
A membrane protein preserves intrabacterial pH in intraphagosomal Mycobacterium tuberculosis. Vandal OH, Pierini LM, Schnappinger D, Nathan CF, Ehrt S. Nat Med. 2008 Aug;14(8):849-54. doi: 10.1038/nm.1795. Epub 2008 Jul 20. 10.1038/nm.1795 PubMed 18641659
Map uploaded by the depositor.
