-
PurposeMulti-purpose expression of a GFP-dependent transcription factor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50020 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCS2+
- Backbone size w/o insert (bp) 4086
- Total vector size (bp) 6534
-
Vector typeMulti-purpose expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGal4DBD-GBP2-IRES-NLS-GBP7-p65AD
-
Alt nameIRES-linked T-DDOG
-
SpeciesSynthetic
-
Insert Size (bp)2448
- Promoter CMV-immediate early promoter and SP6 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GTAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CTGCATTCTAGTTGTGGTTTGTCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGBP2, GBP7 were obtained from Heinrich Leonhardt and Ulrich Rothbauer at Ludwig Maximilian University of Munich
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138.
Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2+ Gal4-GBP2-IRES-GBP7-p65 was a gift from Connie Cepko (Addgene plasmid # 50020 ; http://n2t.net/addgene:50020 ; RRID:Addgene_50020) -
For your References section:
A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Tang JC, Szikra T, Kozorovitskiy Y, Teixiera M, Sabatini BL, Roska B, Cepko CL. Cell. 2013 Aug 15;154(4):928-39. doi: 10.1016/j.cell.2013.07.021. 10.1016/j.cell.2013.07.021 PubMed 23953120