-
PurposeExpression of BTK-mCherry in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50043 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMSCV
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 10000
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBTK
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3000
-
Entrez GeneBtk (a.k.a. xid)
- Promoter pCMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site AvrII (not destroyed)
- 5′ sequencing primer CGCTTCAAGGTGCACATGGAG
- 3′ sequencing primer CACGATGGTGTAGTCCTCGTTGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-BTK-mCherry was a gift from Hidde Ploegh (Addgene plasmid # 50043 ; http://n2t.net/addgene:50043 ; RRID:Addgene_50043) -
For your References section:
Bruton's Tyrosine Kinase (BTK) and Vav1 contribute to Dectin1-dependent phagocytosis of Candida albicans in macrophages. Strijbis K, Tafesse FG, Fairn GD, Witte MD, Dougan SK, Watson N, Spooner E, Esteban A, Vyas VK, Fink GR, Grinstein S, Ploegh HL. PLoS Pathog. 2013 Jun;9(6):e1003446. doi: 10.1371/journal.ppat.1003446. Epub 2013 Jun 27. 10.1371/journal.ppat.1003446 PubMed 23825946