pCVL TLR 3.1 (Sce target) Ef1a iRFP Puro
(Plasmid
#50417)
-
PurposeFluorescent reporter for DNA cleavage/repair in mammalian cells expressing iRFP with selectable puromycin marker.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 50417 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCVL.Active/Repressed TLR (Sce)
-
Modifications to backboneCloned sequence encoding puromycin between NsiI and KpnI from TLR 2.1.
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameeGFP with I-Sce I TS
-
SpeciesH. sapiens (human)
-
Insert Size (bp)759
-
Mutationembedded I-Sce I TS from 163-185
- Promoter SFFV
-
Tags
/ Fusion Proteins
- iRFP (N terminal on backbone)
- T2A dislinker (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NsiI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CAACGTCAACATCAAGTTG
- 3′ sequencing primer GGGCCACAACTCCTCATAAA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert name+3 mCherry
-
Insert Size (bp)708
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that the only difference between this lasmid and Plasmid #45575 is that there is a Puromycin selection marker
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCVL TLR 3.1 (Sce target) Ef1a iRFP Puro was a gift from Andrew Scharenberg (Addgene plasmid # 50417 ; http://n2t.net/addgene:50417 ; RRID:Addgene_50417)