Skip to main content

pCVL TLR 3.1 (Sce target) Ef1a iRFP Puro
(Plasmid #50417)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50417 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCVL.Active/Repressed TLR (Sce)
  • Modifications to backbone
    Cloned sequence encoding puromycin between NsiI and KpnI from TLR 2.1.
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    eGFP with I-Sce I TS
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    759
  • Mutation
    embedded I-Sce I TS from 163-185
  • Promoter SFFV
  • Tags / Fusion Proteins
    • iRFP (N terminal on backbone)
    • T2A dislinker (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NsiI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CAACGTCAACATCAAGTTG
  • 3′ sequencing primer GGGCCACAACTCCTCATAAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    +3 mCherry
  • Insert Size (bp)
    708

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note that the only difference between this lasmid and Plasmid #45575 is that there is a Puromycin selection marker

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCVL TLR 3.1 (Sce target) Ef1a iRFP Puro was a gift from Andrew Scharenberg (Addgene plasmid # 50417 ; http://n2t.net/addgene:50417 ; RRID:Addgene_50417)