Skip to main content

pAAV-hSyn-DIO-HA-rM3D(Gs)-IRES-mCitrine
(Plasmid #50456)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50456 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 7406
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    rM3D-IRES-mCitrine
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2588
  • Mutation
    See supplemental documents for DREADD mutations
  • Entrez Gene
    CHRM3 (a.k.a. EGBRS, HM3, PBS, m3AChR)
  • Promoter human Synapsin 1
  • Tag / Fusion Protein
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Asc I (not destroyed)
  • 3′ cloning site Nhe I (not destroyed)
  • 5′ sequencing primer TCGTGTCGTGCCTGAGAGCG
  • 3′ sequencing primer GCATTAAAGCAGCGTATCCACATAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-DIO-HA-rM3D(Gs)-IRES-mCitrine was a gift from Bryan Roth (Addgene plasmid # 50456 ; http://n2t.net/addgene:50456 ; RRID:Addgene_50456)