Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

FN207
(Plasmid #50497)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 50497 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NM_001306129.1
  • Species
    H. sapiens (human)
  • Mutation
    repeats 6-10
  • Entrez Gene
    FN1 (a.k.a. CIG, ED-B, FINC, FN, FNZ, GFND, GFND2, LETS, MSF, SMDCF)
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site NsiI (not destroyed)
  • 5′ sequencing primer RSET FW (AATACGACTCACTATAGGGAG)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FN207 was a gift from Kenneth Yamada (Addgene plasmid # 50497 ; http://n2t.net/addgene:50497 ; RRID:Addgene_50497)
  • For your References section:

    Requirement for the synergy site for cell adhesion to fibronectin depends on the activation state of integrin alpha 5 beta 1. Danen EH, Aota S, van Kraats AA, Yamada KM, Ruiter DJ, van Muijen GN. J Biol Chem. 1995 Sep 15;270(37):21612-8. 10.1074/jbc.270.37.21612 PubMed 7545166