- 
              Depositing Lab
 - 
          Publication
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 50513 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepEGFPNBC1
 - 
              Backbone manufacturerYamada lab
 - 
              Vector typeMammalian Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameVinculin
 - 
                  Alt nameVCL
 - 
                  Alt namefocal adhesion protein
 - 
                    SpeciesG. gallus (chicken)
 - 
                        Entrez GeneVCL (a.k.a. VINC1)
 - Promoter CMV
 - 
    
        Tag
        / Fusion Protein
    
- EGFP (N terminal on backbone)
 
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site HindIII (not destroyed)
 - 3′ cloning site XbaI (not destroyed)
 - 5′ sequencing primer EGFP FW (CATGGTCCTGCTGGAGTTCGTG)
 - 3′ sequencing primer EGFP RVs (CTCTACAAATGTGGTATGGCTG) (Common Sequencing Primers)
 
Resource Information
- 
            Articles Citing this Plasmid
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
Depositor Comments
modification of Clontech pEGFPC1 MCS
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pEGFP Vinculin was a gift from Kenneth Yamada (Addgene plasmid # 50513 ; http://n2t.net/addgene:50513 ; RRID:Addgene_50513)